 |
 |
|
|
| Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
| circular CDKN2B-AS1 | |||
| Gene | CDKN2B-AS1 | Organism | Human |
| Genome Locus | Build | hg19 | |
| Disease | Inflammatory Bowel Disease | ICD-10 | Noninfective enteritis and colitis (K50-K52) |
| DBLink | PMID | 31207308 | |
| Experimental Method | |||
| Sample Type | Tissue and cell lines | Comparison | Normal controls and patients |
| Method for Estimation | Quantitative PCR | PCR Details | |
| Primers (Experimented) | Forward GCTGGGATTACAGGTGTGAGACACC ReverseGAATCAGAATGAGGCTTATTCTTCTCATC | Statistics | Fold Change : Downregulated pvalue : <0.05 |
| Citation | |||
| Rankin, CR, Lokhandwala, ZA, Huang, R, Pekow, J, Pothoulakis, C, Padua, D (2019). Linear and circular CDKN2B-AS1 expression is associated with Inflammatory Bowel Disease and participates in intestinal barrier formation. Life Sci., 231:116571. | |||